Krt23em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Krt23em1(IMPC)J |
Name: |
keratin 23; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5927759 |
Gene: |
Krt23 Location: Chr11:99368799-99383946 bp, - strand Genetic Position: Chr11, 62.92 cM, cytoband D
|
Alliance: |
Krt23em1(IMPC)J page
|
IMPC: |
Krt23 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGGATTATAACTAAAGGG, TATCACGTGCACGTGTACCT, GTTCACGGAATTATTCCAGT and CAGTGGCTCTTGAACATATA, which resulted in a 276 bp deletion beginning at Chromosome 11 positive strand position 99,486,564 bp and ending after 99,486,839 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000112592 (exon 2) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 1 amino acid later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|