Krt23^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt23^em1(IMPC)J
• Name: keratin 23; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927759
• Gene: Krt23 Location: Chr11:99368799-99383946 bp, - strand Genetic Position: Chr11, 62.92 cM, cytoband D
• Alliance: Krt23^em1(IMPC)J page
• IMPC: Krt23 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGGATTATAACTAAAGGG, TATCACGTGCACGTGTACCT, GTTCACGGAATTATTCCAGT and CAGTGGCTCTTGAACATATA, which resulted in a 276 bp deletion beginning at Chromosome 11 positive strand position 99,486,564 bp and ending after 99,486,839 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000112592 (exon 2) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krt23 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)