Brms1lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Brms1lem1(IMPC)J |
Name: |
breast cancer metastasis-suppressor 1-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5927711 |
Gene: |
Brms1l Location: Chr12:55883109-55916521 bp, + strand Genetic Position: Chr12, 24.18 cM
|
Alliance: |
Brms1lem1(IMPC)J page
|
IMPC: |
Brms1l gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATATGAAACTGGACATCCA, CCACTGAGATTCAGTGACGA and TGAGGCCAGTGAGGTTTTGG, which resulted in a 562 bp deletion beginning at Chromosome 12 positive strand position 55,841,295 bp and ending after 55,841,856 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000654815 (exon 2) and 471 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) insertion at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 6 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|