Impg1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Impg1em1(IMPC)J |
| Name: |
interphotoreceptor matrix proteoglycan 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5927700 |
| Gene: |
Impg1 Location: Chr9:80220612-80347534 bp, - strand Genetic Position: Chr9, 43.99 cM
|
| Alliance: |
Impg1em1(IMPC)J page
|
| IMPC: |
Impg1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAATATCCTAGGAGCAGCA, CCTTAGTAACCATTTCAAAG, TTAAAGTTAGCCATGCAAAA and ATTAGTGTGTGAACATAAGC, which resulted in a 312 bp deletion beginning at Chromosome 9 negative strand position 80,435,559 bp and ending after 80,435,248 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000694908 (exon 3) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 12 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|