Map7d1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Map7d1em1(IMPC)J |
| Name: |
MAP7 domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5927681 |
| Gene: |
Map7d1 Location: Chr4:126125960-126150112 bp, - strand Genetic Position: Chr4, 60.16 cM
|
| Alliance: |
Map7d1em1(IMPC)J page
|
| IMPC: |
Map7d1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACACTATACACAAGGCGGT, TGGAAGTGCTGGCAGACGGG, GGAAGTGACTCAAGTCCATG and GATAGGGATCTATCACACAT, which resulted in a 325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 210 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|