About   Help   FAQ
Map7d1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Map7d1em1(IMPC)J
Name: MAP7 domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5927681
Gene: Map7d1  Location: Chr4:126125960-126150112 bp, - strand  Genetic Position: Chr4, 60.16 cM
Alliance: Map7d1em1(IMPC)J page
IMPC: Map7d1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACACTATACACAAGGCGGT, TGGAAGTGCTGGCAGACGGG, GGAAGTGACTCAAGTCCATG and GATAGGGATCTATCACACAT, which resulted in a 325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 210 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Map7d1 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory