About   Help   FAQ
Pkmyt1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pkmyt1em1(IMPC)J
Name: protein kinase, membrane associated tyrosine/threonine 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5925317
Gene: Pkmyt1  Location: Chr17:23945385-23955709 bp, + strand  Genetic Position: Chr17, 12.02 cM
Alliance: Pkmyt1em1(IMPC)J page
IMPC: Pkmyt1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTTATCATTGCACGCAG, AATGGTAGTCCCCCAAACCA, GCTGATCAGCCACCAACAAA and GTAGTCCCAGATGTTAACTG, which resulted in a 1036 bp deletion beginning at Chromosome 17 positive strand position 23,733,561 bp and ending after 23,734,596 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136277 (exon 3) and 542 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pkmyt1 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory