About   Help   FAQ
Adgrf3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adgrf3em1(IMPC)J
Name: adhesion G protein-coupled receptor F3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912117
Gene: Adgrf3  Location: Chr5:30398429-30410720 bp, - strand  Genetic Position: Chr5, 16.13 cM
Alliance: Adgrf3em1(IMPC)J page
IMPC: Adgrf3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAAGAATCTGAATTCTGA, CTTTCTAGAGACCTCCAGCA, GTACAGGGATAACAAAGAAG and ATGTGGGCCTTGGGTCCAGT, which resulted in a 575 bp deletion beginning at Chromosome 5 negative strand position 30,199,382 bp and ending after 30,198,808 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601748 (exon 8) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 346 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adgrf3 Mutation:  53 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory