Gabrr3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gabrr3em1(IMPC)J |
| Name: |
gamma-aminobutyric acid type A receptor subunit rho 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5912100 |
| Gene: |
Gabrr3 Location: Chr16:59227745-59282102 bp, + strand Genetic Position: Chr16, 34.83 cM
|
| Alliance: |
Gabrr3em1(IMPC)J page
|
| IMPC: |
Gabrr3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTATTCCAATTTCAGAG, CTGAAGTTATGACCCGAGCA, TTAAAGAGTGGGCAACAAGT and AGTGTACAGCAAGTACTTGG, which resulted in a 564 bp deletion beginning at Chromosome 16 positive strand position 59,429,807 bp and ending after 59,430,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000698978 (exon 4) and 340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 29 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|