Gabrr3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gabrr3^em1(IMPC)J
• Name: gamma-aminobutyric acid type A receptor subunit rho 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912100
• Gene: Gabrr3 Location: Chr16:59227745-59282102 bp, + strand Genetic Position: Chr16, 34.83 cM
• Alliance: Gabrr3^em1(IMPC)J page
• IMPC: Gabrr3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTATTCCAATTTCAGAG, CTGAAGTTATGACCCGAGCA, TTAAAGAGTGGGCAACAAGT and AGTGTACAGCAAGTACTTGG, which resulted in a 564 bp deletion beginning at Chromosome 16 positive strand position 59,429,807 bp and ending after 59,430,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000698978 (exon 4) and 340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 29 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gabrr3 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)