About   Help   FAQ
Gabrr3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gabrr3em1(IMPC)J
Name: gamma-aminobutyric acid type A receptor subunit rho 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912100
Gene: Gabrr3  Location: Chr16:59227745-59282102 bp, + strand  Genetic Position: Chr16, 34.83 cM
Alliance: Gabrr3em1(IMPC)J page
IMPC: Gabrr3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTATTCCAATTTCAGAG, CTGAAGTTATGACCCGAGCA, TTAAAGAGTGGGCAACAAGT and AGTGTACAGCAAGTACTTGG, which resulted in a 564 bp deletion beginning at Chromosome 16 positive strand position 59,429,807 bp and ending after 59,430,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000698978 (exon 4) and 340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 29 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gabrr3 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory