Gpr135em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gpr135em1(IMPC)J |
| Name: |
G protein-coupled receptor 135; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5912036 |
| Gene: |
Gpr135 Location: Chr12:72114748-72117875 bp, - strand Genetic Position: Chr12, 30.2 cM
|
| Alliance: |
Gpr135em1(IMPC)J page
|
| IMPC: |
Gpr135 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Gpr135-8910J-7449M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCATAATTCTGAAACC, CCGACTTCCATAACTGAGTC, CGGATGCGCGCTACCCTGCA and CTTGCAGGGTAGCGCGCATC, which resulted in a 1370 bp deletion beginning at Chromosome 12 negative strand position 72,071,005 bp and ending after 72,069,636 bp (GRCm38/mm10). This mutation creates an internal deletion of 1370 bp from ENSMUSE00000353393 (exon 1) including 14 bp of 5 UTR and 1356 bp of coding sequence, leaving 15 bp of coding sequence and a TAA stop. This deletion is predicted to result in a loss of almost all amino acid coding sequence for Grp135 and generate a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|