About   Help   FAQ
Hmgb4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hmgb4em1(IMPC)J
Name: high-mobility group box 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5912021
Gene: Hmgb4  Location: Chr4:128154005-128154688 bp, - strand  Genetic Position: Chr4, 61.97 cM
Alliance: Hmgb4em1(IMPC)J page
IMPC: Hmgb4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATTGTTTCAAACTGGTCT, TCCCCTTCCTGCCTTGACAT, TGGGGGAAAAAGACCAGCTA and TTCTGAAATTCAGCATAAAA, which resulted in a 401 bp deletion beginning at Chromosome 4 negative strand position 128,260,766 bp and ending after 128,260,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000405638 (exon 1) and additionally inserts 14 bp (TCCCAAGAATGGGG) at the deletion site and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 50 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hmgb4 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory