Scrn3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Scrn3em1(IMPC)J |
Name: |
secernin 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5912018 |
Gene: |
Scrn3 Location: Chr2:73142980-73168158 bp, + strand Genetic Position: Chr2, 43.57 cM
|
Alliance: |
Scrn3em1(IMPC)J page
|
IMPC: |
Scrn3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAGTGATCGCCTCTTCCCAA, GGAAGAGGCGATCACTATGA, CACTAATTAGTCCAAGCGCA and TTTCCCACTGTAGATGATGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 73,318,471 bp and ending after 73,318,128 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271539 (exon 3) and 162 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 3 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|