Cpsf7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cpsf7^em1(IMPC)J
• Name: cleavage and polyadenylation specific factor 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911628
• Gene: Cpsf7 Location: Chr19:10502630-10525017 bp, + strand Genetic Position: Chr19, 6.6 cM
• Alliance: Cpsf7^em1(IMPC)J page
• IMPC: Cpsf7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTGATTGAAATATTGCT, GTCTTAATCCCCAAACATAG, GAGACCATCTGTATGAAGGG and GGTTTGGTGGCACAATTAGT, which resulted in a 970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224989 and ENSMUSE00000224978 (exons 4 and 5) and 693 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 50 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cpsf7 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)