About   Help   FAQ
Cpsf7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cpsf7em1(IMPC)J
Name: cleavage and polyadenylation specific factor 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5911628
Gene: Cpsf7  Location: Chr19:10502630-10525017 bp, + strand  Genetic Position: Chr19, 6.6 cM
Alliance: Cpsf7em1(IMPC)J page
IMPC: Cpsf7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTGATTGAAATATTGCT, GTCTTAATCCCCAAACATAG, GAGACCATCTGTATGAAGGG and GGTTTGGTGGCACAATTAGT, which resulted in a 970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224989 and ENSMUSE00000224978 (exons 4 and 5) and 693 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 50 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cpsf7 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory