About   Help   FAQ
Prim1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prim1em1(IMPC)J
Name: DNA primase, p49 subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5911622
Synonyms: Prim1-
Gene: Prim1  Location: Chr10:127851084-127865899 bp, + strand  Genetic Position: Chr10, 76.39 cM, cytoband D3
Alliance: Prim1em1(IMPC)J page
IMPC: Prim1 gene page
Prim1em1(IMPC)J/ Prim1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths with apparent inner cell mass but limited/no trophectoderm or primitive endoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAACTAAAACCTTAACTAAT, GGTTACATTATGCCCTAAAC, ACATTACCTTCAAAACTTGG and TTCTTGCCCCCAAGTTTTGA, which resulted in a 278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp and ending after 128,016,216 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205993 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp insertion (ATCTGA) at the deletion site and a 4 bp deletion (CTAA) 33 bp after the 278 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prim1 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory