Prim1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prim1^em1(IMPC)J
• Name: DNA primase, p49 subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911622
• Synonyms: Prim1^-
• Gene: Prim1 Location: Chr10:127851084-127865899 bp, + strand Genetic Position: Chr10, 76.39 cM, cytoband D3
• Alliance: Prim1^em1(IMPC)J page
• IMPC: Prim1 gene page

Prim1^em1(IMPC)J/ Prim1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths with apparent inner cell mass but limited/no trophectoderm or primitive endoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACATTACCTTCAAAACTTGG, GGTTACATTATGCCCTAAAC, TAACTAAAACCTTAACTAAT, and TTCTTGCCCCCAAGTTTTGA that targeted exon(s) ENSMUSE00001205993.2. This resulted in deletion(s) of 4 bp (location: Chr10:127851771-127851774; GRCm39), 5 bp (location: Chr10:127851713-127851717; GRCm39), and 278 bp (location: Chr10:127851808-127852085; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prim1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)