Cdk18em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cdk18em1(IMPC)J |
Name: |
cyclin dependent kinase 18; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5911515 |
Gene: |
Cdk18 Location: Chr1:132041285-132067433 bp, - strand Genetic Position: Chr1, 57.24 cM
|
Alliance: |
Cdk18em1(IMPC)J page
|
IMPC: |
Cdk18 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACAGCAGTAAATTTAGCA, CACCAGTTTGAGCCCCCCAG, CTAGCTGACATTGGGAAGAA and GACATGCCACTCAGTCTTGT, which resulted in a 226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000159061 (exon 3) and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 87 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|