Cdk18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdk18^em1(IMPC)J
• Name: cyclin dependent kinase 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911515
• Gene: Cdk18 Location: Chr1:132041285-132067433 bp, - strand Genetic Position: Chr1, 57.24 cM
• Alliance: Cdk18^em1(IMPC)J page
• IMPC: Cdk18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACAGCAGTAAATTTAGCA, CACCAGTTTGAGCCCCCCAG, CTAGCTGACATTGGGAAGAA and GACATGCCACTCAGTCTTGT, which resulted in a 226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000159061 (exon 3) and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 87 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdk18 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)