About   Help   FAQ
Dap3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dap3em1(IMPC)J
Name: death associated protein 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5911513
Gene: Dap3  Location: Chr3:88828110-88858488 bp, - strand  Genetic Position: Chr3, 39.01 cM, cytoband F2
Alliance: Dap3em1(IMPC)J page
IMPC: Dap3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGGTGACTGCCTGACAG, GTCTGTAGCTGACCCTTGCG, GATGAGTGTAGGAATCTGGT and TAGTGCACATGCGGTTAGAA, which resulted in a 784 bp deletion beginning at Chromosome 3 negative strand position 88,931,104 bp and ending after 88,930,321 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000567034 and ENSMUSE00000567033 (exons 5-6) and 582 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 5 bp (CATAT) retention of endogenous sequence that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dap3 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory