Tnnc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnnc1^em1(IMPC)J
• Name: troponin C, cardiac/slow skeletal; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911233
• Gene: Tnnc1 Location: Chr14:30930274-30933671 bp, + strand Genetic Position: Chr14, 19.09 cM
• Alliance: Tnnc1^em1(IMPC)J page
• IMPC: Tnnc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AATGCTAACTGTTCTCTCTC, CCCCTCCTCCCCACACTATA, and TGGCCCAAGCAGAGAGGAGA that targeted exon(s) ENSMUSE00001063990.2 ENSMUSE00001792121.1 ENSMUSE00002151720.1. This resulted in deletion(s) of 6 bp (location: Chr14:30932678-30932683; GRCm39), 222 bp (location: Chr14:30932438-30932659; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tnnc1 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)