Sap18em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sap18em1(IMPC)J |
| Name: |
Sin3A-associated polypeptide 18; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5911231 |
| Gene: |
Sap18 Location: Chr14:58035646-58042437 bp, + strand Genetic Position: Chr14, 30.51 cM
|
| Alliance: |
Sap18em1(IMPC)J page
|
| IMPC: |
Sap18 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCGGTAGGATAAGATGGTAG, TGCGGGTTGCGGGCGGCTGC, and TTTAATATCTTGGTGCTGCG that targeted exon(s) ENSMUSE00000122492.2 ENSMUSE00000687277.2 ENSMUSE00000687280.2 ENSMUSE00000741159.2 ENSMUSE00000945691.2. This resulted in deletion(s) of 432 bp (location: Chr14:58035827-58036258; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|