About   Help   FAQ
Cdk2ap2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdk2ap2em1(IMPC)J
Name: cyclin dependent kinase 2 associated protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910604
Gene: Cdk2ap2  Location: Chr19:4147182-4149019 bp, + strand  Genetic Position: Chr19, 3.8 cM
Alliance: Cdk2ap2em1(IMPC)J page
IMPC: Cdk2ap2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCACGTAGAGCTTGTAGG, CCCGGATTGCAAAACTCGAG, CATAAGGAGGTGCCACCAGG and AAAGGGCCCTTCCTGTAGAT, which resulted in a 1715 bp deletion beginning at Chromosome 19 positive strand position 4,097,571 bp and ending after 4,099,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249854, ENSMUSE00001264241, ENSMUSE00000145584 (exons 2-4) and 961 bp of flanking intronic sequence including the splice acceptors and donors and may cause a change of amino acid sequence after residue 27 and early truncation 30 amino acids later by translation of unspliced mRNA. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdk2ap2 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory