About   Help   FAQ
Cep192em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep192em1(IMPC)J
Name: centrosomal protein 192; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910590
Gene: Cep192  Location: Chr18:67933177-68018241 bp, + strand  Genetic Position: Chr18, 40.11 cM, cytoband E1
Alliance: Cep192em1(IMPC)J page
IMPC: Cep192 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGACTGGATAAGTATGT, GATTATTCTCTTTGGAGCTG, TGCTTCACTTACCAACAGCA and GCAGTGTTTTGGTTTGTCAC, which resulted in a 391 bp deletion beginning at Chromosome 18 positive strand position 67,807,133 bp and ending after 67,807,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332162 (exon 5) and 242 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (T) intronic deletion 69 bp before the 391 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 97 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cep192 Mutation:  75 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory