About   Help   FAQ
Ndufa9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ndufa9em1(IMPC)J
Name: NADH:ubiquinone oxidoreductase subunit A9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910587
Synonyms: Ndufa9-
Gene: Ndufa9  Location: Chr6:126798826-126826107 bp, - strand  Genetic Position: Chr6, 61.92 cM, cytoband F3
Alliance: Ndufa9em1(IMPC)J page
IMPC: Ndufa9 gene page
Ndufa9em1(IMPC)J/Ndufa9em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTTTAGAACTTGACCA, GGACTCACGGGTGCTCCACA, GTATTGACAATGAGTAGGCC and GCCTTAGGAAAAATTACTTT, which resulted in a 416 bp deletion beginning at Chromosome 6 positive strand position 126,840,391 bp and ending after 126,840,806 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240808 (exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ndufa9 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory