About   Help   FAQ
Lrrc55em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrrc55em1(IMPC)J
Name: leucine rich repeat containing 55; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910550
Gene: Lrrc55  Location: Chr2:85018411-85029110 bp, - strand  Genetic Position: Chr2, 49.53 cM
Alliance: Lrrc55em1(IMPC)J page
IMPC: Lrrc55 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CGGATACAGCGCTGTACAGC and GCTGGCAGCAGCAGTGCTGT, which resulted in a 702 bp deletion beginning at Chromosome 2 negative strand position 85,196,683 bp and ending after 85,195,982 bp (GRCm38/mm10). This mutation deletes 702 bp from ENSMUSE00000643986 (exon 1) including the ATG start site but retains the last 3 bp (CGG) in the exon and thus the splice donor. While a null is expected, an unidentified alternate start site could potentially permit translation of exon 2. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrrc55 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory