About   Help   FAQ
Zhx1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zhx1em1(IMPC)J
Name: zinc fingers and homeoboxes 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910464
Gene: Zhx1  Location: Chr15:57910399-57939904 bp, - strand  Genetic Position: Chr15, 24.25 cM, cytoband D2
Alliance: Zhx1em1(IMPC)J page
IMPC: Zhx1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GAAGCGGAAGCTTTCTAAAT and AAAATCAACAACACCTTGCA, which resulted in a 2585 bp deletion beginning at Chromosome 15 negative strand position 58,054,823 bp and ending at 58,052,239 bp (GRCm38/mm10). This mutation deletes 2585 bp of ENSMUSE00000125822 (exon 3) coding sequence and is predicted to cause a change of amino acid sequence after residue 8 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zhx1 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory