Gramd1bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gramd1bem1(IMPC)J |
| Name: |
GRAM domain containing 1B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5910393 |
| Gene: |
Gramd1b Location: Chr9:40204529-40442679 bp, - strand Genetic Position: Chr9, 21.42 cM, cytoband B
|
| Alliance: |
Gramd1bem1(IMPC)J page
|
| IMPC: |
Gramd1b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACCTTCTACTACCATGA, GGGAGTTCCAGAGAACACTC, CTTGGCCTCCCAGAGACTAT and GCAATGGACCCACATACTAT, which resulted in a 474 bp deletion beginning at Chromosome 9 negative strand position 40,317,723 bp and ending after 40,317,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256460 (exon 5) and 389 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp insertion (GGTAGTAGAA) at the deletion site that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 229 and early truncation 35 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|