About   Help   FAQ
Gramd1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gramd1bem1(IMPC)J
Name: GRAM domain containing 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910393
Gene: Gramd1b  Location: Chr9:40204529-40442679 bp, - strand  Genetic Position: Chr9, 21.42 cM, cytoband B
Alliance: Gramd1bem1(IMPC)J page
IMPC: Gramd1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACCTTCTACTACCATGA, GGGAGTTCCAGAGAACACTC, CTTGGCCTCCCAGAGACTAT and GCAATGGACCCACATACTAT, which resulted in a 474 bp deletion beginning at Chromosome 9 negative strand position 40,317,723 bp and ending after 40,317,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256460 (exon 5) and 389 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp insertion (GGTAGTAGAA) at the deletion site that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 229 and early truncation 35 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gramd1b Mutation:  120 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory