About   Help   FAQ
Ubap2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ubap2em1(IMPC)J
Name: ubiquitin-associated protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910359
Gene: Ubap2  Location: Chr4:41194313-41275144 bp, - strand  Genetic Position: Chr4, 21.13 cM
Alliance: Ubap2em1(IMPC)J page
IMPC: Ubap2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAACGACCTGCAGCTCAGGT, TCTATAGCATGAATATCTGT, GTAGAGTCTATACCACTAAG and CTTGGCATACTAACTGCAGT, which resulted in a 437 bp deletion beginning at Chromosome 4 negative strand position 41,229,880 bp, and ending after 41,229,444 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205355 (exon 5) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 221 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ubap2 Mutation:  109 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory