Washc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Washc4^em1(IMPC)J
• Name: WASH complex subunit 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910317
• Gene: Washc4 Location: Chr10:83379616-83432337 bp, + strand Genetic Position: Chr10, 41.29 cM
• Alliance: Washc4^em1(IMPC)J page
• IMPC: Washc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCAGCTCCTAAATGGCA, CAAGACTGCTTTGTCAGTGT, ATAAAAGCAGCCTAACCCTA and TTAGGATGTTCAGACACTGC, which resulted in a 258 bp deletion beginning at Chromosome 10 positive strand position 83,554,686 bp GACACTGACAAAGCAGTCTT, and ending after AGGATGTTCAGACACTGCTG at 83,554,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000293860 (exon 7) and 175 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Washc4 Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)