Washc4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Washc4em1(IMPC)J |
| Name: |
WASH complex subunit 4; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5910317 |
| Synonyms: |
Washc4- |
| Gene: |
Washc4 Location: Chr10:83379616-83432337 bp, + strand Genetic Position: Chr10, 41.29 cM
|
| Alliance: |
Washc4em1(IMPC)J page
|
| IMPC: |
Washc4 gene page |
|
Washc4em1(IMPC)J/Washc4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCAGCTCCTAAATGGCA, CAAGACTGCTTTGTCAGTGT, ATAAAAGCAGCCTAACCCTA and TTAGGATGTTCAGACACTGC, which resulted in a 258 bp deletion beginning at Chromosome 10 positive strand position 83,554,686 bp GACACTGACAAAGCAGTCTT, and ending after AGGATGTTCAGACACTGCTG at 83,554,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000293860 (exon 7) and 175 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|