Dhtkd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhtkd1^em1(IMPC)J
• Name: dehydrogenase E1 and transketolase domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5910309
• Gene: Dhtkd1 Location: Chr2:5901030-5947648 bp, - strand Genetic Position: Chr2, 3.62 cM
• Alliance: Dhtkd1^em1(IMPC)J page
• IMPC: Dhtkd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TAGTGGCGAGCGATCTTTGC, GTTTGTAATGGAGCTCACGG and CCGCCCAGAAGGGAAGTCGA, which resulted in a 597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605446 (exon 3) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhtkd1 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)