About   Help   FAQ
Thap1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Thap1em1(IMPC)J
Name: THAP domain containing, apoptosis associated protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909270
Gene: Thap1  Location: Chr8:26648197-26654179 bp, + strand  Genetic Position: Chr8, 14.4 cM
Alliance: Thap1em1(IMPC)J page
IMPC: Thap1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCTGGTTACCAATCTCCCTC, TTTAGTAAGCCGGAGAGTGTand TGTGTTCATGGGAAAAATCA, which resulted in a 597 bp deletion beginning at Chromosome 8 positive strand position 26,160,640 bp, GGGAGATTGGTAACCAGAACT, and ending after TGTTCATGGGAAAAATCAGG at 26,161,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000250934 (exon 2) and 401 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 26 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Thap1 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory