About   Help   FAQ
Retnlgem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Retnlgem1(IMPC)J
Name: resistin like gamma; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909238
Gene: Retnlg  Location: Chr16:48692984-48694859 bp, + strand  Genetic Position: Chr16, 30.75 cM
Alliance: Retnlgem1(IMPC)J page
IMPC: Retnlg gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Retnlg-8758J-9754M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GAGATCACTGAGCTATGGGA, TGAAAGTATTTACTGCATTG and AAGAGCTTAGACCAGGGTAC, which resulted in a 243 bp deletion beginning at Chromosome 16 positive strand position 48,872,815 bp ATAGCTCAGTGATCTCATCT, and ending after GAGCTTTTGCTGATGCTGAC at 48,873,057 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980093 (exon 2) and 91 bp of flanking intronic sequence including the splice acceptor, ATG start site and splice donor. In addition there is a single bp insertion, A, 216 bp before the deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause an early truncation after 6 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Retnlg Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory