Fnbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fnbp1em1(IMPC)J |
Name: |
formin binding protein 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5909220 |
Gene: |
Fnbp1 Location: Chr2:30916218-31032020 bp, - strand Genetic Position: Chr2, 21.78 cM, cytoband B
|
Alliance: |
Fnbp1em1(IMPC)J page
|
IMPC: |
Fnbp1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Fnbp1-8741J-1502M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTGTCCTCCTCCAAAGACA, TCTGGCCTGAGAATAAACAG and TTACAACCCAAACCCGGCCA, which resulted in a 397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281997 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 10 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|