About   Help   FAQ
Cdh7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdh7em1(IMPC)J
Name: cadherin 7, type 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909204
Gene: Cdh7  Location: Chr1:109910161-110067887 bp, + strand  Genetic Position: Chr1, 50.73 cM
Alliance: Cdh7em1(IMPC)J page
IMPC: Cdh7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGATTTCACATTGTATATTC, GACCACGCCTGCACATAGAA and GAAAGAAGCTAGTATGCCAT, which resulted in a total deletion of 650 bp beginning at Chromosome 1 positive strand position 110,048,663 bp GTATATTCTGGCTTCTTAGC, and ending after TTTAATAAATGGCTTGTGTA at 110,049,333 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292496 (exon 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor. Additionally, 55 bp after the end of this exon there is 21 bp of retained endogenous sequence (GTGCAGGCGTGGTCAGAAAGG) followed by an additional 144 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 70 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdh7 Mutation:  63 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory