Eid2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Eid2em1(IMPC)J |
Name: |
EP300 interacting inhibitor of differentiation 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5909135 |
Gene: |
Eid2 Location: Chr7:27967306-27968593 bp, + strand Genetic Position: Chr7, 16.67 cM
|
Alliance: |
Eid2em1(IMPC)J page
|
IMPC: |
Eid2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCGGGGCGCTGCTGACTGC, CTGCGGGGCGCTGCTGACTG, AATCCTCTAATAGAAGAACT and CAATCCTCTAATAGAAGAAC, which resulted in a 658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10). This mutation creates an internal deletion of 658 bp from ENSMUSE00000339928 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 74 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|