About   Help   FAQ
Eid2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Eid2em1(IMPC)J
Name: EP300 interacting inhibitor of differentiation 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5909135
Gene: Eid2  Location: Chr7:27967306-27968593 bp, + strand  Genetic Position: Chr7, 16.67 cM
Alliance: Eid2em1(IMPC)J page
IMPC: Eid2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCGGGGCGCTGCTGACTGC, CTGCGGGGCGCTGCTGACTG, AATCCTCTAATAGAAGAACT and CAATCCTCTAATAGAAGAAC, which resulted in a 658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10). This mutation creates an internal deletion of 658 bp from ENSMUSE00000339928 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 74 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Eid2 Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory