About   Help   FAQ
Zmynd19em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmynd19em1(IMPC)J
Name: zinc finger, MYND domain containing 19; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907980
Gene: Zmynd19  Location: Chr2:24839789-24850882 bp, + strand  Genetic Position: Chr2, 16.86 cM
Alliance: Zmynd19em1(IMPC)J page
IMPC: Zmynd19 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAGGACCCCAAAAGTACAG, TCCGTTCTGGACTTTTTTAA, GTAACCTATGACTCACCAGA and GAGCTTTGCCACTAACCCAA, which resulted in a 461 bp deletion beginning at Chromosome 2 positive strand position 24952462 bp, TACTTTTGGGGTCCTAGGAG, and ending after TGAGACCCATGGATCCTTCT at 24952922 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261744 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 76 bp insertion into the site of the deletion that is an inverted repeat from Chr2:24952847-24952922 (AGAAGCTTTG). The insertion is not expected to alter the results of the exon deletion, which is predicted to cause a change of amino acid sequence after residue 37 and early truncation 39 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zmynd19 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory