Ywhaqem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ywhaqem1(IMPC)J |
| Name: |
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5907862 |
| Gene: |
Ywhaq Location: Chr12:21440330-21467437 bp, - strand Genetic Position: Chr12, 8.31 cM
|
| Alliance: |
Ywhaqem1(IMPC)J page
|
| IMPC: |
Ywhaq gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGTATTCTGGATTTACCCGT, AGTTTTTTGCTATAAACCAT, GAATCATTTAAGGCCTGCCG, which resulted in a 294 bp deletion beginning at Chromosome 12 negative strand position 21,398,513 bp, GCCTGCCGGGGAAGCTAGTA, and ending after TAAGTATATTTGACCCACGG at 21,398,220 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290283 (exon 2) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 2 bp intronic deletion (CC) 19 bp before the 294 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 98 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|