About   Help   FAQ
Ywhaqem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ywhaqem1(IMPC)J
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907862
Gene: Ywhaq  Location: Chr12:21440330-21467437 bp, - strand  Genetic Position: Chr12, 8.31 cM
Alliance: Ywhaqem1(IMPC)J page
IMPC: Ywhaq gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGTATTCTGGATTTACCCGT, AGTTTTTTGCTATAAACCAT, GAATCATTTAAGGCCTGCCG, which resulted in a 294 bp deletion beginning at Chromosome 12 negative strand position 21,398,513 bp, GCCTGCCGGGGAAGCTAGTA, and ending after TAAGTATATTTGACCCACGG at 21,398,220 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290283 (exon 2) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 2 bp intronic deletion (CC) 19 bp before the 294 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 98 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ywhaq Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory