About   Help   FAQ
Scg3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Scg3em1(IMPC)J
Name: secretogranin III; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907855
Gene: Scg3  Location: Chr9:75550471-75591338 bp, - strand  Genetic Position: Chr9, 42.32 cM
Alliance: Scg3em1(IMPC)J page
IMPC: Scg3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGAGCCTAGTACGAAGCAT, GCTGGGCACTAGACATTCCC, ATAGGTTATGAAATGATGCG and GCAAGCACATTTTTACATCT, which resulted in a 406 bp deletion beginning at Chromosome 9 negative strand position 75,676,874 bp, TGAAATGATGCGTGGACTAG, and ending after GCTTGCCAGGGAATGTCTAG at 75,676,469 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217477 (exon 5) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Scg3 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory