Scg3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scg3^em1(IMPC)J
• Name: secretogranin III; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907855
• Gene: Scg3 Location: Chr9:75550471-75591338 bp, - strand Genetic Position: Chr9, 42.32 cM
• Alliance: Scg3^em1(IMPC)J page
• IMPC: Scg3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGAGCCTAGTACGAAGCAT, GCTGGGCACTAGACATTCCC, ATAGGTTATGAAATGATGCG and GCAAGCACATTTTTACATCT, which resulted in a 406 bp deletion beginning at Chromosome 9 negative strand position 75,676,874 bp, TGAAATGATGCGTGGACTAG, and ending after GCTTGCCAGGGAATGTCTAG at 75,676,469 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217477 (exon 5) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Scg3 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)