Rgsl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgsl1^em1(IMPC)J
• Name: regulator of G-protein signaling like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907831
• Gene: Rgsl1 Location: Chr1:153655127-153719888 bp, - strand Genetic Position: Chr1, 65.43 cM
• Alliance: Rgsl1^em1(IMPC)J page
• IMPC: Rgsl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTAGCAGTACACTATG, TGGGAGATCTTTGCTTAATG, CATTTCTGTCCATAGTTTGG and CAAGCTTTCATCTTTGAAAT, which resulted in a 321 bp deletion spanning ENSMUSE00001254521 (exon 12) beginning at Chromosome 1 negative strand position 153,804,855 bp, CTCATGAAACCACCAAACTA, and ending after AAGCCACATTAAGCAAAGAT at 153,804,535 bp (GRCm38/mm10). This mutation deletes exon 12 and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 707 and early truncation 43 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rgsl1 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)