Akr1c19em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Akr1c19em1(IMPC)J |
Name: |
aldo-keto reductase family 1, member C19; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5907829 |
Gene: |
Akr1c19 Location: Chr13:4283499-4298360 bp, + strand Genetic Position: Chr13, 2.36 cM
|
Alliance: |
Akr1c19em1(IMPC)J page
|
IMPC: |
Akr1c19 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCATAGAACTGGATTATCAC, CAGAATTAAACTCCAAGGTG, AGGAGGCTTCTGAACTCATA, which resulted in a 520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980302 (exon 6) and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 190 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|