About   Help   FAQ
Zfp706em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp706em1(IMPC)J
Name: zinc finger protein 706; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907827
Gene: Zfp706  Location: Chr15:36997271-37007646 bp, - strand  Genetic Position: Chr15, 14.59 cM
Alliance: Zfp706em1(IMPC)J page
IMPC: Zfp706 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGACTGTAGATAATATCCT, ACTGCTAGCTGGGAAAATGT, CCAGACAGTTCAAATATCAT and TATACTCATTTGTCATCTAG, which resulted in a 629 bp deletion beginning at Chromosome 15 positive strand position 37,003,474 bp, CTACATTTTCCCAGCTAGCA, and ending after AGTTCAAATATCATTGGTAA at 37,004,102 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000514075 (exon 2) and 492 bp of flanking intronic sequence including the start site and is predicted to cause a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp706 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory