Tssk4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tssk4^em1(IMPC)J
• Name: testis-specific serine kinase 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907824
• Gene: Tssk4 Location: Chr14:55887641-55889996 bp, + strand Genetic Position: Chr14, 28.19 cM, cytoband C1
• Alliance: Tssk4^em1(IMPC)J page
• IMPC: Tssk4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTACTTGAGGTATCTTAG, TTCGAAGTAGTAAGTAGCAA, GTTGTGAGCAGAGCCCAAAA and TATAAAGTGCTCTCACACAG, which resulted in a 706 bp deletion beginning at Chromosome 14 positive strand position 55,650,630 bp, TCTTAGGGGTATAACTATGA, and ending after CATCCTCTCTCCCTTTTGGG at 55,651,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124550 (exon 2) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tssk4 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)