Asf1bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Asf1bem1(IMPC)J |
| Name: |
anti-silencing function 1B histone chaperone; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5907638 |
| Gene: |
Asf1b Location: Chr8:84682323-84696824 bp, + strand Genetic Position: Chr8, 40.22 cM
|
| Alliance: |
Asf1bem1(IMPC)J page
|
| IMPC: |
Asf1b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AGAGGCCTAATTTTCCCGGG, CGAGAGGAACCATATAGTAG, AGTGTGCTTTCAGGTAAAAG, which resulted in a 526 bp deletion spanning ENSMUSE00001257874 (exon 2) beginning at Chromosome 8 positive strand position 83,964,745 bp CTACTATATGGTTCCTCTCG, and ending after CTAGAACCTTCCTCTTTTAC at 83,965,270 bp (GRCm38/mm10). This mutation deletes exon 2 and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 1 amino acid later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|