Asf1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asf1b^em1(IMPC)J
• Name: anti-silencing function 1B histone chaperone; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907638
• Gene: Asf1b Location: Chr8:84682323-84696824 bp, + strand Genetic Position: Chr8, 40.22 cM
• Alliance: Asf1b^em1(IMPC)J page
• IMPC: Asf1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGAGGCCTAATTTTCCCGGG, AGTGTGCTTTCAGGTAAAAG, and CGAGAGGAACCATATAGTAG that targeted exon(s) ENSMUSE00001257874.2. This resulted in deletion(s) of 5 bp (location: Chr8:84691999-84692003; GRCm39), 526 bp (location: Chr8:84691374-84691899; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Asf1b Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)