Ccdc85bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccdc85bem1(IMPC)J |
| Name: |
coiled-coil domain containing 85B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5907253 |
| Gene: |
Ccdc85b Location: Chr19:5503191-5507591 bp, - strand Genetic Position: Chr19, 4.33 cM
|
| Alliance: |
Ccdc85bem1(IMPC)J page
|
| IMPC: |
Ccdc85b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Ccdc85b-8691J-5050M was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCCTCAGTCATCAGGGGAGC and GGAGGCCGAAGCAGGCGGCC, which resulted in a 680 bp deletion beginning at Chromosome 19 negative strand position 5,457,391 bp, GCCGAAGCAGGCGGCCTGGA, and ending after GCTGTGGACCTCCAGACCTG at 5,456,712 bp (GRCm38/mm10). This mutation deletes all of exon ENSMUSE00001034635 except the first 6 bp and an additional 77 bp of flanking intronic sequence and is predicted to cause early truncation after 2 amino acids.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|