Map3k20em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Map3k20em1(IMPC)J |
Name: |
mitogen-activated protein kinase kinase kinase 20; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5906321 |
Gene: |
Map3k20 Location: Chr2:72115981-72272954 bp, + strand Genetic Position: Chr2, 43.11 cM
|
Alliance: |
Map3k20em1(IMPC)J page
|
IMPC: |
Map3k20 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Map3k20-8667J-4407M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAGCACCAAAGAAAAGTA, CATGACGCCATACTTTTCTT, TGCAGAGCCTGACCAGCGCG and TTGTAGGACAGATTAGCTCG, which resulted in a 609 bp deletion beginning at Chromosome 2 positive strand position 72,371,660 bp CTTTTCTTTGGTGCTAAGGT, and ending after CCTGACCAGCGCGAGGCCTG at 72,372,268 bp (GRCm38/mm10). This mutation deletes exons 6 and 7 and 442 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 12 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|