Map3k20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Map3k20^em1(IMPC)J
• Name: mitogen-activated protein kinase kinase kinase 20; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5906321
• Gene: Map3k20 Location: Chr2:72115981-72272954 bp, + strand Genetic Position: Chr2, 43.11 cM
• Alliance: Map3k20^em1(IMPC)J page
• IMPC: Map3k20 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Map3k20-8667J-4407M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAGCACCAAAGAAAAGTA, CATGACGCCATACTTTTCTT, TGCAGAGCCTGACCAGCGCG and TTGTAGGACAGATTAGCTCG, which resulted in a 609 bp deletion beginning at Chromosome 2 positive strand position 72,371,660 bp CTTTTCTTTGGTGCTAAGGT, and ending after CCTGACCAGCGCGAGGCCTG at 72,372,268 bp (GRCm38/mm10). This mutation deletes exons 6 and 7 and 442 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Map3k20 Mutation: 67 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)