About   Help   FAQ
Map3k20em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Map3k20em1(IMPC)J
Name: mitogen-activated protein kinase kinase kinase 20; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5906321
Gene: Map3k20  Location: Chr2:72115981-72272954 bp, + strand  Genetic Position: Chr2, 43.11 cM
Alliance: Map3k20em1(IMPC)J page
IMPC: Map3k20 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Map3k20-8667J-4407M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTAGCACCAAAGAAAAGTA, CATGACGCCATACTTTTCTT, TGCAGAGCCTGACCAGCGCG and TTGTAGGACAGATTAGCTCG, which resulted in a 609 bp deletion beginning at Chromosome 2 positive strand position 72,371,660 bp CTTTTCTTTGGTGCTAAGGT, and ending after CCTGACCAGCGCGAGGCCTG at 72,372,268 bp (GRCm38/mm10). This mutation deletes exons 6 and 7 and 442 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Map3k20 Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory