Sike1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sike1^em1(IMPC)J
• Name: suppressor of IKBKE 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905812
• Gene: Sike1 Location: Chr3:102903056-102911230 bp, + strand Genetic Position: Chr3, 45.25 cM, cytoband F3
• Alliance: Sike1^em1(IMPC)J page
• IMPC: Sike1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sike1-8664J-4439M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGGGGTGGACGCTGCGGG, CTGATTTATCTTGGTCTGGA, GGGAGTGACCACATACCAAA and AGCAGAGTTGAATTGTTAGA, which resulted in a 572 bp deletion in total. This deletion begins at Chromosome 3 positive strand position 102,995,979 bp, GCCGAGCCGCGCCCAGGGGT, deleting 369 bp, then retains 4 endogenous bp (AGTG) in the intron, then removes 203 bp ending after ACCAAATGGAGGCTTCTATA at 102,996,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 470 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sike1 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)