About   Help   FAQ
Sike1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sike1em1(IMPC)J
Name: suppressor of IKBKE 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905812
Gene: Sike1  Location: Chr3:102903056-102911230 bp, + strand  Genetic Position: Chr3, 45.25 cM, cytoband F3
Alliance: Sike1em1(IMPC)J page
IMPC: Sike1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sike1-8664J-4439M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGGGGTGGACGCTGCGGG, CTGATTTATCTTGGTCTGGA, GGGAGTGACCACATACCAAA and AGCAGAGTTGAATTGTTAGA, which resulted in a 572 bp deletion in total. This deletion begins at Chromosome 3 positive strand position 102,995,979 bp, GCCGAGCCGCGCCCAGGGGT, deleting 369 bp, then retains 4 endogenous bp (AGTG) in the intron, then removes 203 bp ending after ACCAAATGGAGGCTTCTATA at 102,996,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 470 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sike1 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory