About   Help   FAQ
Trp53i11em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trp53i11em1(IMPC)J
Name: transformation related protein 53 inducible protein 11; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905785
Gene: Trp53i11  Location: Chr2:93017893-93032104 bp, + strand  Genetic Position: Chr2, 51.37 cM
Alliance: Trp53i11em1(IMPC)J page
IMPC: Trp53i11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Trp53i11-8646J-9616F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGGCCCCCAGGTGTCCAC, GAGAGGTTGAGCTTGCATTG, GTAGGACCTTACACATACCC and CTGTGCAACCCAAACAGCCA, which resulted in a 235 bp deletion beginning at Chromosome 2 positive strand position 93,198,127 bp, TTGGGGAAAACATTTATGTT, and ending after GGATGGTTTTGTGTCCCGGG at 93,198,361 bp (GRCm38/mm10). This mutation deletes exon 4 and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Trp53i11 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory