Slc9a9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc9a9em1(IMPC)J |
| Name: |
solute carrier family 9 (sodium/hydrogen exchanger), member 9; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5905784 |
| Gene: |
Slc9a9 Location: Chr9:94551962-95112498 bp, + strand Genetic Position: Chr9, 49.22 cM
|
| Alliance: |
Slc9a9em1(IMPC)J page
|
| IMPC: |
Slc9a9 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Slc9a9-8597J-8865F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTCAACTATGGGAGACGT, TGTGTCGTTGGAATAAGTCA, AGGCGTATACCTATGTAAAG and ATACAACGCAAATACAGCCC, which resulted in a 563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10). This mutation deletes exon 2 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 58 and early truncation 3 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|