About   Help   FAQ
Rab8aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab8aem1(IMPC)J
Name: RAB8A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905648
Gene: Rab8a  Location: Chr8:72915044-72935210 bp, + strand  Genetic Position: Chr8, 34.84 cM
Alliance: Rab8aem1(IMPC)J page
IMPC: Rab8a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab8a-8582J-1846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGCGACAACAGTAGCTGAA, CTAAAGCCTTCTACAGGCTG, CCAGTGTAGAGTCCAGCGAA and CACGATTCAGGGCCCAAACA, which resulted in a 233 bp deletion beginning at Chromosome 8 positive strand position 72,168,281 bp, CTTCAGCTACTGTTGTCGCC, and ending after GCTAGTGCCTTGTTTGGGCC at 72,168,513 bp (GRCm38/mm10). This mutation deletes exon 2 and 172 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (G) 18 bp after the exon deletion, that will not affect the results of the exon deletion. This allele is predicted to cause a change of amino acid sequence after residue 42 and early truncation 54 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rab8a Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory