Sdhaf2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sdhaf2em1(IMPC)J |
| Name: |
succinate dehydrogenase complex assembly factor 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5904343 |
| Synonyms: |
Sdhaf2- |
| Gene: |
Sdhaf2 Location: Chr19:10477876-10502573 bp, - strand Genetic Position: Chr19, 6.6 cM
|
| Alliance: |
Sdhaf2em1(IMPC)J page
|
| IMPC: |
Sdhaf2 gene page |
|
Sdhaf2em1(IMPC)J/Sdhaf2em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACAGTAACCATTGTCTAACG, ATAAAGGGACCAAAATCCGC, CCAAGATGCAGCTCAGCATA, and GATATGACTTTAGACTCTAA that targeted exon(s) ENSMUSE00000518711.2 ENSMUSE00000519698.2 ENSMUSE00001459062.2 ENSMUSE00002136608.1. This resulted in deletion(s) of 570 bp (location: Chr19:10494287-10494856; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
6 reference(s) |
|