About   Help   FAQ
Sdhaf2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sdhaf2em1(IMPC)J
Name: succinate dehydrogenase complex assembly factor 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5904343
Synonyms: Sdhaf2-
Gene: Sdhaf2  Location: Chr19:10477876-10502573 bp, - strand  Genetic Position: Chr19, 6.6 cM
Alliance: Sdhaf2em1(IMPC)J page
IMPC: Sdhaf2 gene page
Sdhaf2em1(IMPC)J/Sdhaf2em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sdhaf2-8595J-8861M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAAGATGCAGCTCAGCATA, GATATGACTTTAGACTCTAA, ATAAAGGGACCAAAATCCGC and ACAGTAACCATTGTCTAACG, which resulted in a 570 bp deletion beginning at Chromosome 19 negative strand position 10517492 bp CGCAGGACTAAGTGAGATCT, and ending after ATAACAAGCCCATTAGAGTC at 10516923 bp (GRCm38/mm10). This mutation deletes exons 2 and 3 and 242 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sdhaf2 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory