About   Help   FAQ
Rab13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab13em1(IMPC)J
Name: RAB13, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5904340
Gene: Rab13  Location: Chr3:90121022-90133694 bp, + strand  Genetic Position: Chr3, 39.21 cM, cytoband F2
Alliance: Rab13em1(IMPC)J page
IMPC: Rab13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab13-8581J-8563M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGTGGAAAGTATGGTGG, ACCTGAGTACCAGCAGTTAC, GGGTCAAAGGGCAATCTGGC and GGGCAATCTGGCTGGGGACT, which resulted in a 164 bp deletion beginning at Chromosome 3 positive strand position 90,222,162 bp, TTACTGGTGCAGCCCCCACT, and ending after GCTGCCCAGTCCCCAGCCAG at 90,222,325 bp (GRCm38/mm10). This mutation deletes exon 2 and 103 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rab13 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory