Rab13em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rab13em1(IMPC)J |
| Name: |
RAB13, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5904340 |
| Gene: |
Rab13 Location: Chr3:90121022-90133694 bp, + strand Genetic Position: Chr3, 39.21 cM, cytoband F2
|
| Alliance: |
Rab13em1(IMPC)J page
|
| IMPC: |
Rab13 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Rab13-8581J-8563M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGTGGAAAGTATGGTGG, ACCTGAGTACCAGCAGTTAC, GGGTCAAAGGGCAATCTGGC and GGGCAATCTGGCTGGGGACT, which resulted in a 164 bp deletion beginning at Chromosome 3 positive strand position 90,222,162 bp, TTACTGGTGCAGCCCCCACT, and ending after GCTGCCCAGTCCCCAGCCAG at 90,222,325 bp (GRCm38/mm10). This mutation deletes exon 2 and 103 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|