Tat^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tat^em1(IMPC)J
• Name: tyrosine aminotransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904323
• Gene: Tat Location: Chr8:110717069-110726435 bp, + strand Genetic Position: Chr8, 57.38 cM
• Alliance: Tat^em1(IMPC)J page
• IMPC: Tat gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tat-8619J-6295M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATGAACTGCCCTTAAGCAA, GGGGCACGACTGTCAATCAA, TCTTTGCTTCTGCCCCACAT and AGAGTCTCGAAGGACCCCCA, which resulted in a 412 bp deletion beginning at Chromosome 8 positive strand position 109,992,483 bp, GCAAGGGTAGAGGGTGGCTG, and ending after GAGTCTCGAAGGACCCCCAA at 109,992,894 bp (GRCm38/mm10). This mutation deletes exon 4 and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 11 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tat Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)