Idh3bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Idh3bem1(IMPC)J |
| Name: |
isocitrate dehydrogenase 3 (NAD+) beta; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5904256 |
| Gene: |
Idh3b Location: Chr2:130121229-130126371 bp, - strand Genetic Position: Chr2, 63.2 cM, cytoband F3
|
| Alliance: |
Idh3bem1(IMPC)J page
|
| IMPC: |
Idh3b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Idh3b-8297J-2446F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCAGACACAACTAACA, AAATTCCTAAATGTCAGTAG, TTGCCTTCTTTTGGAAACCG and AGGTCAGATCGGGGACACCG, which resulted in a 772 bp deletion beginning at Chromosome 2 negative strand position 130,284,280 bp, GTGTCCCCGATCTGACCTTG, and ending after GGGTCAGACCCTGTTAGTTG at 130,283,509 bp (GRCm38/mm10). This mutation deletes exons 2,3,4 and 474 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|