About   Help   FAQ
Idh3bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Idh3bem1(IMPC)J
Name: isocitrate dehydrogenase 3 (NAD+) beta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5904256
Gene: Idh3b  Location: Chr2:130121229-130126371 bp, - strand  Genetic Position: Chr2, 63.2 cM, cytoband F3
Alliance: Idh3bem1(IMPC)J page
IMPC: Idh3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Idh3b-8297J-2446F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCAGACACAACTAACA, AAATTCCTAAATGTCAGTAG, TTGCCTTCTTTTGGAAACCG and AGGTCAGATCGGGGACACCG, which resulted in a 772 bp deletion beginning at Chromosome 2 negative strand position 130,284,280 bp, GTGTCCCCGATCTGACCTTG, and ending after GGGTCAGACCCTGTTAGTTG at 130,283,509 bp (GRCm38/mm10). This mutation deletes exons 2,3,4 and 474 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Idh3b Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory