Dusp22^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp22^em1(IMPC)J
• Name: dual specificity phosphatase 22; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5903750
• Gene: Dusp22 Location: Chr13:30844042-30895215 bp, + strand Genetic Position: Chr13, 13.26 cM
• Alliance: Dusp22^em1(IMPC)J page
• IMPC: Dusp22 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intragenic deletion, Inversion
• Mutation details: This allele from project Dusp22-8513J-1842M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCCTGCTCCTAAGTGCAGG, CATGTTTGCCAAGGCCGTGA, CACTCAAACCCCAAGTCACA and CCCTGGCAATACCTTTTTGA, which resulted in a 490 bp deletion beginning at Chromosome 13 positive strand position 30,668,607 bp, GCAGGGGGTTGAAAGATTAC, and ending after TACCCTGGCAATACCTTTTT at 30,669,096 bp (GRCm38/mm10). This mutation deletes exon 2 and 456 bp of flanking intronic sequence including the splice acceptor and donor. In addition 71 bp upstream of the 490 bp deletion there is a deletion of 78 bp (Chr:13 30,668,458 bp - 30,668,535 bp) of intronic sequence that was replaced with 73 bp, the majority of which derived from the opposite strand of the excised sequence that reinserted in reverse orientation and should not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 7 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dusp22 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)