Dgkb^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dgkb^em1(IMPC)J
• Name: diacylglycerol kinase, beta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5903234
• Gene: Dgkb Location: Chr12:37930169-38684238 bp, + strand Genetic Position: Chr12, 17.11 cM
• Alliance: Dgkb^em1(IMPC)J page
• IMPC: Dgkb gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dgkb-8572J-5198M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAGATGTTTCTATCTCCA, AAGATGAAGCCAAGGCTTAG, ATGTCTCTAGCAAAATAAGT and GGATACTGGATACTCTATAA, which resulted in a 566 bp deletion beginning at Chromosome 12 positive strand position 38,100,137 bp, GGAGATAGAAACATCTAACT, and ending after AGTAGGGTAGAAAATAGTAT at 38,100,702 bp (GRCm38/mm10). This mutation deletes exon 4 and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dgkb Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)